Kulshrestha, S and Hallan, Vipin and Raikhy, G and Zaidi, A A (2010) DEVELOPMENT OF DIAGNOSTIC KIT AGAINST THE RECOMBINANT COAT PROTEIN OF PRUNUS NECROTIC RINGSPOT VIRUS. Journal of Prunus necrotic ringspot virus.

Full text not available from this repository.

Abstract

1. Primers useful for detection of Prunus necrotic ringspot virus (PNRSV) in plants, comprising the following sequence: Sequence ID 1: upstream primer AACTGCAGATGGTTTGCCGAATTTGCAA Sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC 2. A method for detection of Prunus necrotic ringspot virus (PNRSV) in plants, wherein the said method comprising the steps of: b) providing a purified coat protein of PNRSV by using designed primers of Sequence ID 1: upstream primer AACTGCAGATGGTTTGCCGAATTTGCAA Sequence ID 2: downstream primer GCTCTAGACTAGATCTCAAGCAGGTC; b) preparing polyclonal antibodies against PNRSV coat protein obtained from step (a); c) performing direct antibody sandwich enzyme linked immunosorbent assay (DAS ELISA) for detection of PNRSV.

Item Type:	Article
Subjects:	Plant sciences Plant viruses
Divisions:	UNSPECIFIED
Depositing User:	Dr. Aparna Maitra Pati
Date Deposited:	02 Jan 2012 07:55
Last Modified:	02 Jan 2012 07:55
URI:	http://ihbt.csircentral.net/id/eprint/737

Actions (login required)

View Item